| Type: | Package |
| Title: | Genome-Wide Nucleic Acid Melting Temperature Profiling and Multi-Omics Integration |
| Version: | 1.0.8 |
| Date: | 2026-07-28 |
| Description: | Accurate calculation of nucleic acid melting temperature (Tm) is fundamental to many molecular biology applications, and this software scales Tm analysis from individual sequences to genome‑wide thermodynamic profiling. This package extends Tm analysis from simple sequence level computation to comprehensive genome-wide thermodynamic profiling. It takes multiple input formats including sequence strings, FASTA files, genomic coordinates. The implementation provides three Tm calculation methods: the Wallace rule (Thein & Wallace, 1986), empirical GC‑content formulas (Marmur, 1962; Schildkraut, 2010; Wetmur, 1991; Untergasser, 2012; von Ahsen, 2001), and nearest‑neighbor thermodynamics (Breslauer, 1986; Sugimoto, 1996; Allawi, 1998; SantaLucia, 2004; Freier, 1986; Xia, 1998; Chen, 2012; Bommarito, 2000; Turner, 2010; Sugimoto, 1995; Allawi, 1997; SantaLucia, 2005). Corrections are supported for salt ions (SantaLucia, 1996, 1998; Owczarzy, 2004, 2008) and for chemical conditions such as dimethyl sulfoxide and formamide. This package returns result as a GRanges object for interoperability with Bioconductor workflows and downstream multi-omics analyses. Data-level integration reconciles Tm windows with external multi-omics GRanges objects through overlap, nearest-feature, windowed-count, and binned-average strategies, returning a single unified GRanges object ready for downstream analysis. Visualization-level integration renders multiple feature layers as independent concentric tracks on a shared genomic axis, each retaining its native coordinate resolution. Group comparison supports Wilcoxon rank-sum and Student's t-tests with multiple available correction methods for contrasting Tm and other features across region classes. |
| BugReports: | https://github.com/JunhuiLi1017/TmCalculator/issues |
| License: | MIT + file LICENSE |
| Depends: | R (≥ 3.5) |
| VignetteBuilder: | knitr |
| Imports: | BSgenome, BiocGenerics, Biostrings, GenomeInfoDb, GenomicRanges, IRanges, S4Vectors, graphics, grDevices, methods |
| Suggests: | testthat (≥ 3.0.0), knitr, utils, rmarkdown, remotes, BiocManager, BSgenomeForge, BSgenome.Hsapiens.UCSC.hg38, karyoploteR, ggplot2, ggridges, ggforce, rlang, seqinr |
| NeedsCompilation: | no |
| Repository: | CRAN |
| RoxygenNote: | 7.3.2 |
| LazyData: | true |
| LazyDataCompression: | xz |
| Encoding: | UTF-8 |
| Packaged: | 2026-07-28 16:57:25 UTC; lij11 |
| Author: | Junhui Li |
| Maintainer: | Junhui Li <ljh.biostat@gmail.com> |
| Date/Publication: | 2026-07-29 05:20:08 UTC |
TmCalculator: Genome-Wide Nucleic Acid Melting Temperature Profiling and Multi-Omics Integration
Description
Accurate calculation of nucleic acid melting temperature (Tm) is fundamental to many molecular biology applications, and this software scales Tm analysis from individual sequences to genome‑wide thermodynamic profiling. This package extends Tm analysis from simple sequence level computation to comprehensive genome-wide thermodynamic profiling. It takes multiple input formats including sequence strings, FASTA files, genomic coordinates. The implementation provides three Tm calculation methods: the Wallace rule (Thein & Wallace, 1986), empirical GC‑content formulas (Marmur, 1962; Schildkraut, 2010; Wetmur, 1991; Untergasser, 2012; von Ahsen, 2001), and nearest‑neighbor thermodynamics (Breslauer, 1986; Sugimoto, 1996; Allawi, 1998; SantaLucia, 2004; Freier, 1986; Xia, 1998; Chen, 2012; Bommarito, 2000; Turner, 2010; Sugimoto, 1995; Allawi, 1997; SantaLucia, 2005). Corrections are supported for salt ions (SantaLucia, 1996, 1998; Owczarzy, 2004, 2008) and for chemical conditions such as dimethyl sulfoxide and formamide. This package returns result as a GRanges object for interoperability with Bioconductor workflows and downstream multi-omics analyses. Data-level integration reconciles Tm windows with external multi-omics GRanges objects through overlap, nearest-feature, windowed-count, and binned-average strategies, returning a single unified GRanges object ready for downstream analysis. Visualization-level integration renders multiple feature layers as independent concentric tracks on a shared genomic axis, each retaining its native coordinate resolution. Group comparison supports Wilcoxon rank-sum and Student's t-tests with multiple available correction methods for contrasting Tm and other features across region classes.
Author(s)
Maintainer: Junhui Li ljh.biostat@gmail.com (ORCID)
Authors:
Lihua Julie Zhu julie.zhu@umassmed.edu (ORCID)
See Also
Useful links:
Report bugs at https://github.com/JunhuiLi1017/TmCalculator/issues
Filter windows with too many N bases
Description
Reads each window sequence and drops those where the N fraction exceeds max_N_frac. Uses batched getSeq for efficiency.
Usage
.filter_N_windows(bsgenome, chr, win_starts, win_ends, max_N_frac, window)
Detect the first and last non-N positions on a chromosome
Description
Uses a coarse block scan to find the positions of the first and last non-N base on a chromosome. Efficient because it only reads N_scan_block bp at a time from each end.
Usage
.find_N_bounds(bsgenome, chr, chr_start, chr_end, block_size)
Load the BSgenome object from an installed BSgenome.* data package
Description
The genome object name is given by the BSgenomeObjname field in
DESCRIPTION (e.g. Hsapiens), not necessarily the package name.
Usage
.get_bsgenome_from_pkg(pkg)
Arguments
pkg |
Character scalar: installed BSgenome package name. |
Value
A BSgenome object.
Sequence extraction by preloading whole chromosomes
Description
Sequence extraction by preloading whole chromosomes
Usage
.getseq_preload_chr(gr_query, genome_objs, parsed)
Arguments
gr_query |
Query |
genome_objs |
Named list of BSgenome objects. |
parsed |
Parsed coordinate data frame. |
Value
DNAStringSet of extracted sequences.
Vectorized sequence extraction with getSeq
Description
Vectorized sequence extraction with getSeq
Usage
.getseq_vectorized(gr_query, genome_objs, parsed)
Arguments
gr_query |
Query |
genome_objs |
Named list of BSgenome objects. |
parsed |
Parsed coordinate data frame. |
Value
DNAStringSet of extracted sequences.
Load installed BSgenome packages
Description
Load installed BSgenome packages
Usage
.load_genome_packages(pkg_names)
Arguments
pkg_names |
Character vector of BSgenome package names. |
Value
Named list of genome objects.
Normalize Tm/GC metadata column names on a GRanges object
Description
Renames legacy lowercase tm/gc columns to Tm/GC.
Usage
.normalize_tm_gc_metadata(gr)
Parse coordinate strings into a data frame
Description
Parse coordinate strings into a data frame
Usage
.parse_coord_strings(coord_vec, pkg_name_override = NULL)
Arguments
coord_vec |
Character vector of colon-separated coordinate strings. |
pkg_name_override |
Optional BSgenome package name for 4-field strings. |
Value
Data frame with columns chr, win_start, win_end,
strand, pkg_name, and region_id.
convert a vector of characters into a string
Description
Simply convert a vector of characters such as c("H","e","l","l","o","W","o","r","l","d") into a single string "HelloWorld".
Usage
c2s(characters)
Arguments
characters |
A vector of characters |
Value
Retrun a strings
Author(s)
Junhui Li
References
citation("TmCalculator")
Filter invalid bases in nucleotide sequences
Description
This function processes nucleotide sequences by converting characters to uppercase and replacing invalid bases with "". based on the specified method. The function preserves the sequence length and attributes (name and Tm) of each sequence.
Usage
check_filter_seq(seq_list, method)
Arguments
seq_list |
Input sequence in 5' to 3' direction. Must be provided as: - A list of sequences with attributes (name and Tm) |
method |
Method to determine valid bases: TM_Wallace: Valid bases are "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W" and "Y" TM_GC: Valid bases are "A","B","C","D","G","H","I","K","M","N","R","S","T","V","W", "X" and "Y" TM_NN: Valid bases are "A","C","G","I" and "T" |
Value
Returns a list of sequences with the same structure as input, where invalid bases are replaced with ""
Author(s)
Junhui Li
References
citation("TmCalculator")
Corrections of melting temperature with chemical substances
Description
Apply corrections to melting temperature calculations based on the presence of DMSO and formamide. These corrections are rough approximations and should be used with caution.
Usage
chem_correct(
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65,
pt_gc = NULL
)
Arguments
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 DMSO can lower the melting temperature of nucleic acid duplexes. |
formamide_unit |
A list containing formamide concentration information: - value: numeric value of formamide concentration - unit: character string specifying the unit ("percent" or "molar") Default: list(value=0, unit="percent") |
dmso_factor |
Coefficient of melting temperature (Tm) decrease per percent DMSO. Default: 0.75 (von Ahsen N, 2001, PMID:11673362) Other published values: 0.5, 0.6, 0.675 |
formamide_factor |
Coefficient of melting temperature (Tm) decrease per percent formamide. Default: 0.65 Literature reports values ranging from 0.6 to 0.72 |
pt_gc |
Percentage of GC content in the sequence (0-100 This is used in molar formamide corrections. |
Details
When formamide_unit$unit = "percent": Correction = - factor * percentage_of_formamide
When formamide_unit$unit = "molar": Correction = (0.453 * GC/100 - 2.88) * formamide
Author(s)
Junhui Li
References
von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
Examples
# DMSO correction
chem_correct(DMSO = 3)
# Formamide correction (percent)
chem_correct(formamide_unit = list(value = 1.25, unit = "percent"), pt_gc = 50)
# Formamide correction (molar)
chem_correct(formamide_unit = list(value = 1.25, unit = "molar"), pt_gc = 50)
Compare numeric GRanges metadata across groups
Description
Test whether one or more numeric metadata columns (e.g. Tm, GC)
differ between levels of a categorical grouping column in a GRanges
object.
Usage
compare_groups(
gr,
target = "Tm",
method = c("wilcoxon", "t.test"),
group,
min_n_per_group = 2L,
paired = FALSE,
alternative = c("two.sided", "less", "greater"),
posthoc = TRUE,
p.adjust.method = c("holm", "hochberg", "hommel", "bonferroni", "BH", "BY", "fdr",
"none")
)
Arguments
gr |
A |
target |
Character vector of metadata column names to test (e.g.
|
method |
Statistical test family. One of:
|
group |
Character. Name of a metadata column in |
min_n_per_group |
Minimum number of non-missing observations required
per group. Default: |
paired |
Logical. Only for exactly two groups. Default: |
alternative |
Character. Alternative hypothesis for two-group tests.
One of |
posthoc |
Logical. For |
p.adjust.method |
Multiple-testing correction for post-hoc pairwise
comparisons. Passed to |
Details
The test used depends on method and the number of group levels:
| Groups | method = "wilcoxon" | method = "t.test" |
| 2 | Wilcoxon rank-sum (or signed-rank if paired = TRUE) |
Welch two-sample t-test (or paired t-test) |
\ge 3 | Kruskal-Wallis | One-way ANOVA (Welch) |
When there are three or more groups and posthoc = TRUE, pairwise
follow-up tests are run (Wilcoxon or Welch t-test) with p.adjust
multiple-testing correction.
Value
A list with:
resultsData frame with one row per
target: omnibus test name, statistic,p.value, and group information.summaryPer-group descriptive statistics (
n,mean,sd,median).pairwisePairwise comparisons when
posthoc = TRUEand there are\ge3 groups; otherwiseNULL.
Author(s)
Junhui Li
Examples
## Not run:
library(GenomicRanges)
set.seed(1)
gr <- GRanges(
seqnames = rep("chr1", 90),
ranges = IRanges(start = sort(sample(1e6, 90)), width = 50),
Tm = c(rnorm(30, 74, 2), rnorm(30, 70, 2), rnorm(30, 66, 2)),
GC = runif(90, 40, 60)
)
gr$group <- rep(c("high", "mid", "low"), each = 30)
# Two groups
gr2 <- gr[gr$group %in% c("high", "low")]
compare_groups(gr2, target = "Tm", group = "group", posthoc = FALSE)
# Three or more groups (Kruskal-Wallis + pairwise Wilcoxon)
compare_groups(gr, target = c("Tm", "GC"), group = "group",
method = "wilcoxon")
# Three or more groups (one-way ANOVA + pairwise t-tests)
compare_groups(gr, target = "Tm", group = "group", method = "t.test")
# Post-hoc with Benjamini-Hochberg FDR control
compare_groups(gr, target = "Tm", group = "group",
p.adjust.method = "BH")
## End(Not run)
Fast complement and reverse complement
Description
Uses chartr() instead of character-by-character translation. ~10x faster than the seqinr-style implementation for long sequences.
Usage
complement_fast(seq_str, rev = FALSE)
Arguments
seq_str |
Character string or vector. |
rev |
Logical. Return reverse complement? Default FALSE. |
Value
Character string(s) with complement.
Convert genomic coordinate strings to a GRanges object
Description
Fast conversion of genomic coordinate strings to a GRanges object with
reference sequences fetched from installed BSgenome.* packages.
Designed for large sliding-window inputs: genome packages are loaded once,
coordinate strings are parsed in one pass, and sequences are extracted with
vectorized getSeq (or optional chromosome
preloading).
Usage
coor_to_genomic_ranges(
input,
complement_seq = NULL,
method = c("vectorized", "preload_chr")
)
Arguments
input |
Coordinate input. Either:
Supported colon-separated formats:
|
complement_seq |
Optional complement coordinates in the same format as
|
method |
Sequence extraction strategy:
|
Details
For genome-wide tiling with thousands of windows, pass coordinates as
list(pkg_name = "BSgenome.Hsapiens.UCSC.hg38", seq = ...) so the
genome package is loaded once instead of per interval.
Value
A GRanges object with metadata columns:
sequenceReference sequence for each interval.
complementComplementary sequence.
GCGC fraction (0-1) per interval.
region_idRegion identifier from the coordinate string.
genome_pkgBSgenome package name used.
Author(s)
Junhui Li
See Also
to_genomic_ranges, to_genomic_ranges_fast
Examples
## Not run:
coords <- c(
"chr1:1000-1199:+:win1",
"chr1:1200-1399:+:win2"
)
gr <- coor_to_genomic_ranges(
list(pkg_name = "BSgenome.Hsapiens.UCSC.hg38", seq = coords)
)
gr
## End(Not run)
E. coli K-12 MG1655 replication-associated hotspot annotations
Description
A named list of genomic feature tables for *Escherichia coli* K-12 MG1655
(NCBI assembly GCF_000005845.2 / ASM584v2, chromosome U00096.3).
The data support the genome-wide Tm vignette and
plot_genome_track examples by providing independent multi-omics
layers that can be overlaid on the same genomic axis alongside Tm profiles
computed with tm_calculate.
Usage
ecoli_rep_hotspots
Format
A named list with five elements:
all_peaks_IP_mutHA data frame (38 rows) of MutL protein ChIP-seq peaks marking mismatch-repair-associated regions (MutL-AR). Columns:
chr,start,end,Sample,name,Size.bins_repA data frame (4,642 rows) of tandem-repeat (microsatellite) counts in non-overlapping 1 kb bins. Columns:
chr,start,end,count.bins_cruA data frame (4,642 rows) of cruciform-forming sequence counts in non-overlapping 1 kb bins. Columns:
chr,start,end,count.ssdnaA data frame (2,636 rows) of single-stranded DNA regions. Columns:
chr,start,end,Cells..strand.,Region.bins_gatcA data frame (4,642 rows) of GATC methylation-site counts in non-overlapping 1 kb bins. Columns:
chr,start,end,count.
All coordinate-based tables use chr = "U00096.3" and are compatible
with plot_genome_track and compare_groups.
Source
Curated from published *E. coli* K-12 MG1655 multi-omics datasets
used in the package vignette
vignette("genome_wide_tm_ecoli", package = "TmCalculator").
Examples
data(ecoli_rep_hotspots)
names(ecoli_rep_hotspots)
# MutL-AR peak coordinates
head(ecoli_rep_hotspots$all_peaks_IP_mutH)
# Microsatellite density in 1 kb bins
summary(ecoli_rep_hotspots$bins_rep$count)
Convert FASTA file to GenomicRanges object
Description
This function reads sequences from a FASTA file and converts them to a GenomicRanges object. If named with format ">chr2:1-10:[+|-]:[seq_name]", the name will be parsed into GRanges components.
Usage
fa_to_genomic_ranges(input_seq)
Arguments
input_seq |
Path to the input FASTA file |
Value
A GenomicRanges object containing: - GRanges information (seqnames, ranges, strand) - sequence data from FASTA file - Complementary sequences (if provided) - Names from FASTA headers
Examples
# Example with single FASTA file
input_seq <- system.file("extdata", "example1.fasta", package = "TmCalculator")
gr <- fa_to_genomic_ranges(input_seq)
Calculate G and C content of nucleotide sequences
Description
Calculate G and C content of nucleotide sequences. The function calculates the percentage of G and C bases relative to the total number of A, T, G, and C bases in the sequence.
Usage
gc(input_seq, ambiguous = FALSE)
Arguments
input_seq |
Sequence (5' to 3') of one strand of the nucleic acid duplex. Can be provided as either: - A character string (e.g., "ATGCG") - A path to a FASTA file containing the sequence(s) |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. For example: - S (G or C) contributes fully to GC content - W (A or T) contributes fully to AT content - M (A or C) contributes proportionally based on the ratio of A to C in the sequence - And so on for other ambiguous bases |
Value
Content of G and C as a percentage (range from 0 to 100
Author(s)
Junhui Li
Examples
# Calculate GC content of a DNA sequence
gc(c("a","t","c","t","g","g","g","c","c","a","g","t","a")) # 53.85%
# Calculate GC content including ambiguous bases
gc("GCATSWSYK", ambiguous = TRUE) # 55.56%
Generate complementary sequence
Description
Generate the complementary sequence of a nucleic acid sequence, with an option to reverse it.
Usage
generate_complement(input_seq, reverse = FALSE)
Arguments
input_seq |
Input sequence(s) in 5' to 3' direction. Must be provided as either: - A character string (e.g., c("ATGCG", "GCTAG")) |
reverse |
Logical. If TRUE, the complementary sequence is reversed (3' to 5'). If FALSE (default), the complementary sequence is in the same direction (5' to 3'). |
Value
Returns the complementary sequence(s) in the specified direction.
Author(s)
Junhui Li
References
citation("TmCalculator")
Examples
# Generate complementary sequence in same direction (5' to 3')
generate_complement("ATGCG", reverse = FALSE)
# Generate complementary sequence in reverse direction (3' to 5')
generate_complement("ATGCG", reverse = TRUE)
Integrate a Tm GRanges with multi-omic feature ranges
Description
Combines the output of tm_calculate (a GRanges object with
Tm and GC columns) with a second GRanges carrying
arbitrary multi-omic metadata (ChIP-seq peaks, ATAC-seq signal, methylation
sites, gene annotations, etc.) using one of four positional strategies:
"overlap"Each tm range is annotated with the aggregated metadata of all feature ranges it directly overlaps.
"nearest"Each tm range is annotated with the metadata of its single closest feature range, plus an added distance column.
"window"Each tm range is expanded symmetrically by
window_sizebp and annotated with aggregated metadata from all features that fall within the expanded window."bin"The genomic space covered by the data is tiled into equal-width bins. Each bin is annotated with the mean tm / GC of overlapping tm ranges and the aggregated feature values - suitable for joint heatmaps and genome-wide correlation analyses.
For strategies "overlap" and "window", when a single Tm range
matches multiple features the default behaviour is to summarise:
numeric columns are aggregated via agg_fun (default mean),
and categorical columns are collapsed to a comma-separated string of unique
values.
Usage
integrate_granges(
gr_tm,
gr_features,
strategy = c("overlap", "nearest", "window", "bin"),
feature_cols = NULL,
prefix = "",
window_size = 1000L,
bin_size = 1e+06,
agg_fun = mean,
min_overlap = 1L,
ignore_strand = TRUE,
keep_unmatched = TRUE,
distance_col = "distance_to_feature"
)
Arguments
gr_tm |
A |
gr_features |
A |
strategy |
Character. Integration strategy. One of
|
feature_cols |
Character vector. Names of metadata columns in
|
prefix |
Character. Prefix prepended to transferred column names to
avoid clashes with existing columns in |
window_size |
Integer. Half-width (bp) of the symmetric window added
around each Tm range in |
bin_size |
Integer. Width (bp) of genomic bins in |
agg_fun |
Function. Applied to numeric feature values when multiple
features map to the same Tm range / bin. Must accept a numeric vector and
an |
min_overlap |
Integer. Minimum overlap in base pairs required between
a Tm range and a feature range in |
ignore_strand |
Logical. If |
keep_unmatched |
Logical. In |
distance_col |
Character. Name of the distance column added in
|
Value
-
"overlap","nearest","window": AGRangesobject with the same ranges asgr_tm(minus unmatched ranges ifkeep_unmatched = FALSE), with additional metadata columns fromgr_features. -
"bin": A newGRangesof genomic bins. Each bin carriesTm_mean,GC_mean(if available),n_tm_ranges,n_features, and one aggregated column per requested feature column.
Author(s)
Junhui Li
Examples
## Not run:
library(GenomicRanges)
# -- Sample data ----------------------------------------------------------
set.seed(42)
gr_tm <- GRanges(
seqnames = c(rep("chr1", 60), rep("chr2", 30)),
ranges = IRanges(
start = c(sort(sample(1:249e6, 60)),
sort(sample(1:243e6, 30))),
width = sample(50:200, 90, replace = TRUE)
),
Tm = runif(90, 55, 85),
GC = runif(90, 30, 70)
)
gr_features <- GRanges(
seqnames = c(rep("chr1", 40), rep("chr2", 20)),
ranges = IRanges(
start = c(sort(sample(1:249e6, 40)),
sort(sample(1:243e6, 20))),
width = sample(500:5000, 60, replace = TRUE)
),
score = runif(60, 0, 100),
peak_type = sample(c("narrow", "broad"), 60, replace = TRUE),
signal = rnorm(60, 5, 2)
)
# Strategy 1: overlap - annotate Tm ranges with overlapping peak features
res_overlap <- integrate_granges(gr_tm, gr_features,
strategy = "overlap")
# Strategy 2: nearest - every Tm range gets its closest peak + distance
res_nearest <- integrate_granges(gr_tm, gr_features,
strategy = "nearest")
head(res_nearest$distance_to_feature)
# Strategy 3: window - 5 kb window around each probe
res_window <- integrate_granges(gr_tm, gr_features,
strategy = "window", window_size = 5000)
# Strategy 4: bin - 500 kb genome bins with mean Tm and aggregated signal
res_bin <- integrate_granges(gr_tm, gr_features,
strategy = "bin", bin_size = 5e5)
as.data.frame(res_bin) |> head()
# Use a subset of feature columns and add a prefix
integrate_granges(gr_tm, gr_features,
strategy = "overlap",
feature_cols = c("score", "peak_type"),
prefix = "chip_")
## End(Not run)
Generate sliding-window genomic coordinate strings for Tm calculation
Description
Tiles one or more chromosomes from a BSgenome object into
overlapping windows and returns a named character vector of coordinate
strings in the format
"chr:start-end:strand:genome_pkg:region_id".
This vector is the primary input for downstream Tm calculation
functions (tm_nn, tm_gc, tm_wallace) that
accept genomic coordinate strings.
Usage
make_genomiccoord(
bsgenome,
chromosomes = NULL,
window = 200L,
slide = 50L,
start = NULL,
end = NULL,
strand = "+",
trim_N = c("ends", "filter", "none"),
max_N_frac = 0.1,
N_scan_block = window,
region_prefix = "region",
genome_pkg_name = NULL,
as_vector = TRUE,
verbose = TRUE
)
Arguments
bsgenome |
A |
chromosomes |
Character vector of chromosome names to tile.
Must be present in |
window |
Integer. Width of each sliding window in base
pairs. Default |
slide |
Integer. Step size between consecutive window
starts in base pairs. |
start |
Integer or |
end |
Integer or |
strand |
Character. Strand label embedded in the
coordinate string. One of |
trim_N |
Character. N-base handling strategy. One of
|
max_N_frac |
Numeric in |
N_scan_block |
Integer. Block size (bp) for the coarse N-end
detection scan used by |
region_prefix |
Character. Prefix for region IDs embedded in
the coordinate string. Default |
genome_pkg_name |
Character or |
as_vector |
Logical. When |
verbose |
Logical. Print per-chromosome progress messages.
Default |
Value
When as_vector = TRUE (default): a named character
vector of coordinate strings, one element per window. Names are
the region IDs (region1, region2, ...).
When as_vector = FALSE: a data.frame with columns
coord, chr, win_start, win_end,
strand, genome, region_id,
chr_start_used, chr_end_used.
Coordinate string format
Each element of the returned vector follows the pattern:
chr1:10001-10200:+:BSgenome.Hsapiens.UCSC.hg38:region1 chr1:10051-10250:+:BSgenome.Hsapiens.UCSC.hg38:region2 ...
Fields (colon-separated):
-
chromosome – e.g.
chr1 -
start-end – 1-based, inclusive coordinates
-
strand –
+or- -
genome – BSgenome package name (character)
-
region_id – unique label
regionN
N-base trimming
Human (and most mammalian) chromosomes begin and end with long
stretches of N bases that represent assembly gaps. Windows
that consist entirely or predominantly of Ns produce
meaningless Tm values. The function offers two trimming strategies
controlled by trim_N:
"none"No trimming. Windows start at
startand end atend(or chromosome length)."ends"Detect the first and last positions of non-
Nbases on each chromosome usingBiostrings::letterFrequency()on a coarse block scan, then trimstartandendto those positions. Efficient: reads the chromosome sequence only once in blocks."filter"Generate windows across the full
start-endrange but then remove any window whose N-base fraction exceedsmax_N_frac(default 0.1, i.e. 10%). More granular than"ends"but slower because it reads each window sequence.
Author(s)
Junhui Li
See Also
tm_nn, tm_gc,
tm_wallace, BSgenome,
letterFrequency
Examples
## Not run:
library(BSgenome.Hsapiens.UCSC.hg38)
## -- Basic usage: tile chr1 with 200 bp windows, 50 bp slide ----------
coords <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L
)
length(coords) # number of windows on chr1
head(coords, 3)
# region1 "chr1:10001-10200:+:BSgenome.Hsapiens.UCSC.hg38:region1"
# region2 "chr1:10051-10250:+:BSgenome.Hsapiens.UCSC.hg38:region2"
# region3 "chr1:10101-10300:+:BSgenome.Hsapiens.UCSC.hg38:region3"
## -- Non-overlapping tiling (slide == window) -------------------------
coords_nonoverlap <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = paste0("chr", 1:22),
window = 200L,
slide = 200L # no overlap
)
length(coords_nonoverlap) # ~15 million windows across autosomes
## -- Custom start/end (e.g. a specific sub-region) --------------------
coords_sub <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
start = 1000000L,
end = 2000000L
)
length(coords_sub) # 19,981 windows in 1 Mb region
## -- No N-trimming (use full chromosome length) ------------------------
coords_noN <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
trim_N = "none"
)
## -- Per-window N-filtering (removes windows with >10% N) -------------
coords_filt <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
trim_N = "filter",
max_N_frac = 0.10
)
## -- Get data.frame output for GRanges construction -------------------
df <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 50L,
as_vector = FALSE
)
gr <- GenomicRanges::GRanges(
seqnames = df$chr,
ranges = IRanges::IRanges(start = df$win_start, end = df$win_end),
strand = df$strand
)
## -- Pass directly to tm_nn -------------------------------------------
coords <- make_genomiccoord(
bsgenome = BSgenome.Hsapiens.UCSC.hg38,
chromosomes = "chr1",
window = 200L,
slide = 200L,
start = 1000000L,
end = 1010000L
)
tm_results <- tm_nn(coords, Na = 50)
## End(Not run)
Plot genome tracks in linear or circular layout
Description
Visualise genomic tracks as either a linear karyoploteR plot or a circular
plot (base R graphics).
Set circular = TRUE to switch to the circular layout; the same
track_list works for both views without modification.
Supported track types in each list element:
type = "rect" : data as GRanges/data.frame, drawn as rectangles
type = "line" : data as GRanges/data.frame with value_col, drawn as lines
type = "area" : same as line but filled (linear only)
type = "region": piled-up regions (linear only)
type = "coverage": coverage area plot (linear only)
A track with ideogram = TRUE is drawn inside the chromosome bar
(linear) or as the outermost ring with a grey background (circular).
Only "rect" type is supported for ideogram tracks.
A per-track height field (numeric, default 1) controls relative
sizing. In linear mode heights are proportional fractions of the data
panel; in circular mode they scale the radial thickness of each ring.
A per-track highlight field (list or list-of-lists with
data/col/alpha/border) draws highlight bands within that track only.
Entries with type = "highlight" draw translucent bands spanning
all real tracks. These accept: data, col (default "#F1C40F"),
alpha (default 0.18), border (default NA), and min.degree (circular only,
default 0.4).
Each list element may also contain: name, col, bg.col, border, ylim, lwd, alpha (0–1 transparency), legend_font_col, ideogram, height, highlight.
Usage
plot_genome_track(
genome_name,
genome_size = NULL,
genome = NULL,
track_list,
circular = FALSE,
label = NULL,
chromosomes = NULL,
zoom = NULL,
plot.type = 1,
track.gap = 0.01,
legend.show = TRUE,
legend.position = NULL,
legend.cex = 0.6,
legend.bty = "n",
legend.border = NA,
legend.font.col = "black",
legend.lwd = 1,
legend.seg.len = -0.5,
legend.box.lwd = 0.25,
legend.x.intersp = 1,
legend.lty = 1,
axis.cex = NULL,
title.cex = NULL,
base.tick.dist = NULL,
start.degree = 34.47,
track.height = 0.05,
gap.after = 0,
cell.padding = c(0, 0, 0, 0),
track.margin = c(0.005, 0.005),
circle.margin = c(0.001, 0.001),
canvas.xlim = c(-1, 1),
canvas.ylim = c(-1, 1),
axis.unit = "Mb",
axis.step = NULL,
axis.show.unit = FALSE,
label.column = 4,
label.niceFacing = TRUE,
label.cex = 0.6,
label.side = "inside",
label.labels_height = 0.01,
label.connection_height = 0.03,
label.line_lwd = 0.25
)
Arguments
genome_name |
Character. Used for the title. |
genome_size |
Numeric. Total genome length (single-chromosome genomes). |
genome |
Optional GRanges, or a karyoploteR genome string (e.g.
|
track_list |
List of track specs (see above). |
circular |
Logical. If |
label |
Optional data.frame/GRanges with labels. |
chromosomes |
Character vector to restrict/reorder chromosomes (linear only). |
zoom |
A GRanges object, a character string, or a character vector
specifying one or more regions to zoom into (e.g.
|
plot.type |
karyoploteR plot.type (linear only). |
track.gap |
Relative gap between tracks (linear only, 0 to ~0.05). |
legend.show |
Logical. |
legend.position |
Legend position. Character for linear (e.g. "topright"), numeric vector of length 2 for circular (e.g. c(0.75, 1)). |
legend.cex, legend.bty, legend.border |
See |
legend.font.col |
Character. Default legend text colour. |
legend.lwd, legend.seg.len, legend.box.lwd, legend.x.intersp, legend.lty |
Additional legend parameters. |
axis.cex |
Axis label size. |
title.cex |
Title size. |
base.tick.dist |
Numeric or NULL (linear only). |
start.degree |
Numeric. Starting angle in degrees for the circular layout (default 34.47, matching the circlize convention). |
track.height, gap.after, cell.padding, track.margin |
Kept for backward compatibility; ignored in the base R circular layout. |
circle.margin |
Numeric vector (length 2 or 4) controlling plot margins
as fractions of the device size. Length 2 is recycled as
|
canvas.xlim, canvas.ylim |
Numeric length-2 vectors controlling the plotting window (circular only). Adjust to pan or zoom into a portion of the circle. |
axis.unit, axis.step, axis.show.unit |
Circular axis parameters. |
label.column, label.niceFacing, label.cex, label.side, label.labels_height, label.connection_height, label.line_lwd |
Circular label parameters. |
Value
Invisibly returns the KaryoPlot object (linear) or NULL
(circular).
Examples
## Not run:
data(ecoli_rep_hotspots)
library("BSgenome.Ecoli.NCBI.ASM584v2")
genome_name <- "BSgenome.Ecoli.NCBI.ASM584v2"
chr_name <- "U00096.3"
genome <- get(genome_name, envir = asNamespace(genome_name))
chr_length <- length(genome[[chr_name]])
genome_name="BSgenome.Ecoli.NCBI.ASM584v2"
bins_gc <- make_genomiccoord(
bsgenome = genome_name,
chromosomes = chr_name,
window = 200L,
slide = 200L,
start = 1,
end = chr_length,
strand = "+"
)
input_new <- list(pkg_name = genome_name, seq = bins_gc)
gr_batch <- to_genomic_ranges_fast(input_new)
tm_ASM584v2 <- tm_calculate(
gr_batch,
method = "tm_nn"
)
Tm <- as.data.frame(tm_ASM584v2$gr[, c("Tm", "GC")])
tracks <- list(
list(type = "rect", data = ecoli_rep_hotspots$all_peaks_IP_mutH,
col = "#2C3E50", bg.col = "grey", name = "MutL-AR",
legend_font_col = "#2C3E50", ideogram = TRUE, height = 0.5),
list(type = "line", data = Tm, value_col = "GC",
name = "GC content", col = "#4A90E2",
legend_font_col = "#4A90E2"),
list(type = "line", data = Tm, value_col = "Tm",
name = "Melting temp", col = "#E06666",
legend_font_col = "#E06666", height = 2),
list(type = "line", data = ecoli_rep_hotspots$bins_rep,
value_col = "count", name = "Microsatellites", col = "#2ECC71",
legend_font_col = "#2ECC71"),
list(type = "line", data = ecoli_rep_hotspots$bins_cru,
value_col = "count", name = "Cruciform", col = "#3B3E6B",
legend_font_col = "#3B3E6B"),
list(data = ecoli_rep_hotspots$ssdna, name = "ssDNA",
col = "#8E44AD", legend_font_col = "#8E44AD"),
list(type = "line", data = ecoli_rep_hotspots$bins_gatc,
value_col = "count", name = "GATC sites", col = "#D35400",
legend_font_col = "#D35400"),
list(type = "highlight", data = ecoli_rep_hotspots$all_peaks_IP_mutH,
col = "#F1C40F", alpha = 0.18)
)
# Circular
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks, circular = TRUE)
# Linear
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks)
# Linear zoom (single region)
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks,
zoom = "U00096.3:1000000-2000000")
# Linear zoom (multiple regions — stacked panels)
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks,
zoom = c("U00096.3:1000000-1200000",
"U00096.3:3000000-3200000"))
# Circular zoom (multiple regions — concatenated arcs)
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks, circular = TRUE,
zoom = c("U00096.3:1000000-1200000",
"U00096.3:3000000-3200000"))
# Circular with canvas panning
plot_genome_track("E. coli", genome_size = 4641652,
track_list = tracks, circular = TRUE,
canvas.xlim = c(0.5, 1), canvas.ylim = c(0, 1),
circle.margin = c(0.05, 0.05))
## End(Not run)
Compare Tm distributions across groups
Description
Visualise how melting temperature (and optionally other numeric metadata)
differs between region classes such as peak vs. non-peak, mutant vs.
wild-type, or any categorical annotation stored in a GRanges object.
Designed as the visual companion to compare_groups().
Usage
plot_tm(
gr,
group,
value = "Tm",
plot_type = c("box", "violin", "rank", "density", "ridgeline", "ecdf", "sina"),
color_palette = c("viridis", "magma", "plasma", "inferno", "cividis"),
show_points = FALSE,
point_size = 1,
point_alpha = 0.3,
notch = FALSE,
add_mean = FALSE,
facet_by = NULL,
show_pvalue = FALSE,
p_adjust_method = "BH",
title = NULL,
ylab = "Tm (°C)",
xlab = NULL,
show_legend = TRUE
)
Arguments
gr |
A |
group |
Character. Name of the metadata column that defines the groups
to compare (e.g. |
value |
Character. Numeric metadata column to plot on the y-axis.
Default: |
plot_type |
Character. Visualisation style:
|
color_palette |
Character. Viridis palette for group colours:
|
show_points |
Logical. Overlay jittered points on box / violin plots.
Default: |
point_size |
Numeric. Point size. Default: |
point_alpha |
Numeric in |
notch |
Logical. Draw notched box plots (approximate 95% CI for
median). Default: |
add_mean |
Logical. Add a diamond marker at the group mean on box /
violin plots. Default: |
facet_by |
Character or |
show_pvalue |
Logical. Annotate the plot with Wilcoxon rank-sum test
p-values. For two groups a single p-value is shown; for three or more
groups all pairwise comparisons are displayed. P-values are placed as
bracket annotations on box / violin / sina plots, or as a subtitle on
density / ecdf / rank / ridgeline plots. Default: |
p_adjust_method |
Character. Method for p-value adjustment when there
are more than two groups (passed to |
title |
Character or |
ylab |
Character. Y-axis label. Default: |
xlab |
Character. X-axis label. Default: group column name for
box/violin/sina, |
show_legend |
Logical. Show colour legend. Default: |
Details
The function pairs naturally with integrate_granges() and
compare_groups():
Use
integrate_granges()to annotate Tm windows with feature overlaps (e.g. ChIP-seq peaks, repeat classes).Use
compare_groups()for the statistical test.Use
plot_tm()to visualise the distributional difference.
Value
A ggplot object.
Examples
## Not run:
library(GenomicRanges)
data(ecoli_rep_hotspots)
library("BSgenome.Ecoli.NCBI.ASM584v2")
genome_name <- "BSgenome.Ecoli.NCBI.ASM584v2"
chr_name <- "U00096.3"
genome <- get(genome_name, envir = asNamespace(genome_name))
chr_length <- length(genome[[chr_name]])
genome_name="BSgenome.Ecoli.NCBI.ASM584v2"
bins_gc <- make_genomiccoord(
bsgenome = genome_name,
chromosomes = chr_name,
window = 200L,
slide = 200L,
start = 1,
end = chr_length,
strand = "+"
)
input_new <- list(pkg_name = genome_name, seq = bins_gc)
gr_batch <- to_genomic_ranges_fast(input_new)
tm_ASM584v2 <- tm_calculate(
gr_batch,
method = "tm_nn"
)
gr_tm <- tm_ASM584v2$gr
# Annotate with MutL-AR peak membership
mutH_peaks <- GRanges(
seqnames = ecoli_rep_hotspots$all_peaks_IP_mutH$chr,
ranges = IRanges(start = ecoli_rep_hotspots$all_peaks_IP_mutH$start,
end = ecoli_rep_hotspots$all_peaks_IP_mutH$end)
)
mutH_peaks$peak_id <- paste0("mutH_", seq_along(mutH_peaks))
gr_annot <- integrate_granges(
gr_tm = gr_tm, gr_features = mutH_peaks,
strategy = "overlap", feature_cols = "peak_id",
keep_unmatched = TRUE
)
gr_annot$in_mutH <- ifelse(is.na(gr_annot$peak_id), "non_peak", "peak")
# Box plot — peak vs non-peak Tm
plot_tm(gr_annot, group = "in_mutH")
# Box plot with Wilcoxon p-value bracket
plot_tm(gr_annot, group = "in_mutH", show_pvalue = TRUE)
# Violin plot with p-value and jittered points
plot_tm(gr_annot, group = "in_mutH", plot_type = "violin",
show_points = TRUE, show_pvalue = TRUE)
# Rank plot — visual Wilcoxon test with p-value subtitle
plot_tm(gr_annot, group = "in_mutH", plot_type = "rank",
show_pvalue = TRUE)
# Density overlay with p-value
plot_tm(gr_annot, group = "in_mutH", plot_type = "density",
show_pvalue = TRUE)
# ECDF — cumulative distribution comparison
plot_tm(gr_annot, group = "in_mutH", plot_type = "ecdf",
show_pvalue = TRUE)
# Compare GC content instead of Tm
plot_tm(gr_annot, group = "in_mutH", value = "GC", ylab = "GC content",
show_pvalue = TRUE)
# Notched box plot with mean markers and p-value
plot_tm(gr_annot, group = "in_mutH", notch = TRUE, add_mean = TRUE,
show_pvalue = TRUE)
## End(Not run)
Prints melting temperature from a TmCalculator object
Description
print.TmCalculator prints to console the melting temperature value from an object of
class TmCalculator.
Usage
## S3 method for class 'TmCalculator'
print(x, ...)
Arguments
x |
An object of class |
... |
Unused |
Value
The melting temperature value.
convert a string into a vector of characters
Description
Simply convert a single string such as "HelloWorld" into a vector of characters such as c("H","e","l","l","o","W","o","r","l","d")
Usage
s2c(strings)
Arguments
strings |
A single string such as "HelloWorld" |
Value
Retrun a vector of characters
Author(s)
Junhui Li
References
citation("TmCalculator")
Corrections of melting temperature with salt concentration
Description
Apply corrections to melting temperature calculations based on salt concentrations. Different correction methods are available for various experimental conditions.
Usage
salt_correct(
Na = 0,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"SantaLucia1998-2", "Owczarzy2004", "Owczarzy2008"),
input_seq,
ambiguous = FALSE
)
Arguments
Na |
Millimolar concentration of sodium ions. Default: 0 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
method |
Method for calculating salt concentration corrections to the melting temperature. Available options: - "Schildkraut2010": Updated salt correction method - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "SantaLucia1998-2": Alternative DNA salt correction (requires input_seq) - "Owczarzy2004": Comprehensive salt correction (requires input_seq) - "Owczarzy2008": Updated comprehensive salt correction (requires input_seq) Note: Setting to NA disables salt correction |
input_seq |
Sequence (5' to 3') of one strand of the nucleic acid duplex. Can be provided as either: - A character string (e.g., "ATGCG") - A path to a FASTA file containing the sequence(s) Required for methods: "SantaLucia1998-2", "Owczarzy2004", and "Owczarzy2008" |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. |
Details
Different correction methods are available for various experimental conditions:
- Schildkraut2010: Updated salt correction method that accounts for monovalent and divalent cations - Wetmur1991: Classic salt correction method for monovalent cations - SantaLucia1996: DNA-specific salt correction - SantaLucia1998-1: Improved DNA salt correction - SantaLucia1998-2: Alternative DNA salt correction (requires sequence information) - Owczarzy2004: Comprehensive salt correction including effects of divalent cations (requires sequence information) - Owczarzy2008: Updated comprehensive salt correction (requires sequence information)
Author(s)
Junhui Li
References
Schildkraut C, Lifson S. Dependence of the melting temperature of DNA on salt concentration. Biopolymers. 1965;3(2):195-208.
Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. Critical Reviews in Biochemistry and Molecular Biology. 1991;26(3-4):227-259.
SantaLucia J. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences. 1998;95(4):1460-1465.
Owczarzy R, Moreira BG, Manthey JA, et al. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry. 2008;47(19):5336-5353.
Examples
salt_correct(Na = 50, Mg = 1.5, method = "Owczarzy2008",
input_seq = "ATGCGATGCG")
Thermodynamic parameters for GC-based Tm calculation methods
Description
A data frame containing coefficients and parameters for different GC-based Tm calculation methods. Each row represents a different method with its specific coefficients (A, B, C, D) and salt correction method.
Usage
thermodynamic_gc_params
Format
A data frame with 8 rows and 5 columns:
- A
Intercept coefficient
- B
GC content coefficient
- C
Length correction coefficient
- D
Mismatch coefficient
- salt_correct
Associated salt correction method
Details
The methods included are: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41(Percentage_GC) - 675/N + 16.6 x log10[Na+] - Wetmur1991_MELTING: Tm = 81.5 + 0.41(Percentage_GC) - 500/N + Wetmur salt - - Wetmur1991_RNA: Tm = 78 + 0.7(Percentage_GC) - 500/N + Wetmur salt - - Wetmur1991_RNA/DNA: Tm = 67 + 0.8(Percentage_GC) - 500/N + Wetmur salt - - Primer3Plus: Tm = 81.5 + 0.41(Percentage_GC) - 600/N + 16.6 x log10[Na+] - vonAhsen2001: Tm = 77.1 + 0.41(Percentage_GC) - 528/N + 11.7 x log10[Na+]
Thermodynamic Tables for Nucleic Acid Hybridization
Description
A comprehensive collection of thermodynamic parameters used for calculating melting temperatures of nucleic acid duplexes. The dataset includes parameters for DNA/DNA, RNA/RNA, RNA/DNA and 2'-O-methylRNA/RNA hybridizations, plus parameters for mismatches, dangling ends, internal / bulge loops, GU wobble, CNG repeats, inosine, hydroxyadenine, azobenzene and locked nucleic acids (LNA).
Usage
thermodynamic_nn_params
Format
A named list of two-column matrices with
colnames = c("left", "right") (left = \Delta H,
right = \Delta S). Rownames are dinucleotide step keys such as
"AT/TA", mismatch / dangling-end keys, or feature-specific keys
(e.g. "CAG_4" for the (CAG)4 CNG entry).
Populated tables
- DNA_NN_Breslauer_1986
DNA/DNA NN, Breslauer et al. (1986)
- DNA_NN_Sugimoto_1996
DNA/DNA NN, Sugimoto et al. (1996)
- DNA_NN_Allawi_1998
DNA/DNA NN, Allawi (1998)
- DNA_NN_SantaLucia_2004
DNA/DNA NN, SantaLucia & Hicks (2004)
- RNA_NN_Freier_1986
RNA/RNA NN, Freier (1986)
- RNA_NN_Xia_1998
RNA/RNA NN, Xia (1998)
- RNA_NN_Chen_2012
RNA/RNA NN with GU, Chen / Serra (2012)
- RNA_DNA_NN_Sugimoto_1995
RNA/DNA hybrid NN, Sugimoto (1995)
- DNA_IMM_Peyret_1999
DNA single internal mismatch, Peyret (1999)
- DNA_TMM_Bommarito_2000
DNA terminal mismatch, Bommarito (2000)
- DNA_DE_Bommarito_2000
DNA single dangling end, Bommarito (2000)
- RNA_DE_Turner_2010
RNA single dangling end, Turner (2010)
Registered placeholders (values TBD - populate from primary literature)
- DNA_NN_AllSan_1997
Allawi & SantaLucia (1997) Biochemistry 36:10581
- DNA_NN_SantaLucia_1996
SantaLucia et al. (1996) Biochemistry 35:3555
- DNA_NN_Tanaka_2004
Tanaka et al. (2004) Biochemistry 43:7143
- MeRNA_RNA_NN_Kierzek_2006
Kierzek et al. (2006) Biochemistry 45:581
- DNA_RNA_IMM_Watkins_2011
Watkins et al. (2011) Nucleic Acids Res 39:1894
- RNA_IMM_Lu_2006
Lu et al. (2006) Nucleic Acids Res 34:4912
- RNA_IMM_Davis_Znosko_2007
Davis & Znosko (2007) Biochemistry 46:13425
- RNA_IMM_Davis_Znosko_2008
Davis & Znosko (2008) Biochemistry 47:10178
- DNA_TandemMM_AllSanPey
Allawi & SantaLucia (1997/1998); Peyret (1999)
- RNA_TandemMM_Mathews_1999
Mathews et al. (1999) JMB 288:911
- DNA_DE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DE_Serra_2008
O'Toole / Serra (2006, 2008)
- DNA_DDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_DDE_OToole_2005
O'Toole et al. (2005) Biochemistry 44:14914
- RNA_DDE_OToole_2006
O'Toole et al. (2006) NAR 34:3338
- DNA_LDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- RNA_LDE_Ohmichi_2002
Ohmichi et al. (2002) JACS 124:10367
- DNA_IL_SantaLucia_2004
SantaLucia & Hicks (2004)
- RNA_IL_Lu_2006
Lu et al. (2006) NAR 34:4912
- RNA_IL_Badhwar_2007
Badhwar et al. (2007) Biochemistry 46:14715
- DNA_SBL_Tanaka_2007
Tan & Chen (2007) Biophys J 92:3615
- DNA_SBL_SantaLucia_2004
SantaLucia & Hicks (2004)
- RNA_SBL_Lu_2006
Lu et al. (2006) NAR 34:4912
- RNA_SBL_Blose_2007
Blose et al. (2007) Biochemistry 46:15123
- DNA_LBL_SantaLucia_2004
SantaLucia & Hicks (2004)
- RNA_LBL_Lu_2006
Mathews (1999); Lu et al. (2006)
- RNA_GU_Mathews_1999
Mathews & Turner (1999) JMB 288:911
- RNA_GU_Chen_2012
Chen / Serra (2012)
- DNA_CNG_Broda_2005
Broda et al. (2005) Biochemistry 44:13851 - rownames use
paste0("C", N, "G_", n), e.g."CAG_4".- DNA_INO_SantaLucia_2005
Watkins & SantaLucia (2005) NAR 33:6258
- RNA_INO_Wright_2007
Wright et al. (2007) Biochemistry 46:4625
- DNA_HA_Kawakami_2001
Kawakami / Sugimoto (2001) Biochemistry 40:14040
- DNA_AZB_Asanuma_2005
Asanuma et al. (2005) Angew Chem Int Ed 44:2747
- DNA_LNA_Owczarzy_2011
Owczarzy et al. (2011) Biochemistry 50:9352
- DNA_LNA_McTigue_2004
McTigue et al. (2004) Biochemistry 43:5388
- DNA_cLNA_Owczarzy_2011
Owczarzy et al. (2011) Biochemistry 50:9352
- DNA_cLNA_MM_Owczarzy_2011
Owczarzy et al. (2011) Biochemistry 50:9352
To add the numeric values for any placeholder table, construct a matrix
with two columns (\Delta H kcal/mol, \Delta S cal/(mol*K)) and
the dinucleotide-step rownames described above, then assign it:
thermodynamic_nn_params$DNA_CNG_Broda_2005 <- new_table
Details
Coverage mirrors the rmelting (Bioconductor) vignette sections 4.2.1 - 4.4.
Tables whose numeric values are not yet ported from primary literature are
included in the list as NULL placeholders so that
tm_nn can still dispatch on the table name; the corresponding
contribution is silently skipped after a one-time package-startup notice.
Source
Various publications as cited above.
References
Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746> Sugimoto N (1996) <doi:10.1093/nar/24.22.4501> Allawi H (1998) <doi:10.1093/nar/26.11.2694> SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800> Freier S (1986) <doi:10.1073/pnas.83.24.9373> Xia T (1998) <doi:10.1021/bi9809425> Chen JL (2012) <doi:10.1021/bi3002709> Sugimoto N (1995) <doi:10.1016/S0048-9697(98)00088-6> Bommarito S (2000) <doi:10.1093/nar/28.9.1929> Peyret N (1999) <doi:10.1021/bi9825091> Allawi H T & SantaLucia J (1997) <doi:10.1021/bi962590c> SantaLucia J (2005) <doi:10.1093/nar/gki918> Turner D H (2010) <doi:10.1093/nar/gkp892> Tanaka F (2004) Biochemistry 43:7143 Kierzek E (2006) Biochemistry 45:581 Watkins N E (2011) Nucleic Acids Res 39:1894 Lu Z J (2006) Nucleic Acids Res 34:4912 Davis A R & Znosko B M (2007, 2008) Biochemistry Mathews D H (1999) <doi:10.1006/jmbi.1999.2700> Ohmichi T (2002) J Am Chem Soc 124:10367 O'Toole A S (2005, 2006) Biochemistry / Nucleic Acids Res Badhwar J (2007) Biochemistry 46:14715 Tan Z J & Chen S J (2007) Biophys J 92:3615 Blose J M (2007) Biochemistry 46:15123 Broda M (2005) <doi:10.1021/bi0501447> Wright D J (2007) Biochemistry 46:4625 Kawakami J / Sugimoto N (2001) <doi:10.1021/bi010918b> Asanuma H (2005) Angew Chem Int Ed 44:2747 McTigue P M (2004) Biochemistry 43:5388 Owczarzy R (2011) Biochemistry 50:9352
Examples
# Access DNA/DNA nearest neighbor parameters
thermodynamic_nn_params$DNA_NN_SantaLucia_2004
# Access DNA internal mismatch parameters
thermodynamic_nn_params$DNA_IMM_Peyret_1999
# See which tables are still placeholders (NULL)
names(Filter(is.null, thermodynamic_nn_params))
Calculate melting temperature using multiple methods
Description
Calculates melting temperature using multiple methods: - Nearest Neighbor thermodynamics (tm_nn) - GC content-based method (tm_gc) - Wallace rule (tm_wallace)
Usage
tm_calculate(
input_seq,
method = c("tm_nn", "tm_gc", "tm_wallace"),
complement_seq = NULL,
ambiguous = FALSE,
shift = 0,
nn_table = c("DNA_NN_SantaLucia_2004", "DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996",
"DNA_NN_Allawi_1998", "RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012",
"RNA_DNA_NN_Sugimoto_1995"),
tmm_table = "DNA_TMM_Bommarito_2000",
imm_table = "DNA_IMM_Peyret_1999",
de_table = c("DNA_DE_Bommarito_2000", "RNA_DE_Turner_2010"),
dnac_high = 25,
dnac_low = 25,
self_comp = FALSE,
variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
"Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
userset = NULL,
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"Owczarzy2004", "Owczarzy2008"),
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65,
mismatch = TRUE
)
Arguments
input_seq |
Input sequence(s) in 5' to 3' direction. Can be provided as either:
- A character string (e.g., "ATGCG")
- A path to a FASTA file containing the sequence(s)
- A GRanges object with sequence and complement metadata should be provided if mismatch is TRUE
- A character vector where each element is a string in the format "chr:start-end:strand:species" (e.g., "chr1:100-200:+:BSgenome.Hsapiens.UCSC.hg38"). Strand is "+" for positive (default if not provided) or "-" for negative.
- chr: Chromosome ID
- start: Start position
- end: End position
- strand: positive or negtive strand
- species: Species name for reference genome (e.g., "BSgenome.Hsapiens.UCSC.hg38"), see |
method |
Method(s) to use for Tm calculation. Can be one or more of: - "tm_nn": Nearest Neighbor thermodynamics (default) - "tm_gc": GC content-based method - "tm_wallace": Wallace rule Default: c("tm_nn", "tm_gc", "tm_wallace") |
complement_seq |
Complementary sequence(s) in 3' to 5' direction. If not provided, the function will automatically generate it from input_seq. This is the template/target sequence that the input sequence will hybridize with. Can be provided as input_seq format besides A NULL value(default) |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. Default: FALSE |
shift |
Integer value controlling the alignment offset between primer and template sequences. Only applicable for the NN method. Default: 0 |
nn_table |
Thermodynamic nearest-neighbor parameters for different nucleic acid hybridizations. Only applicable for the NN method. Default: "DNA_NN_SantaLucia_2004" |
tmm_table |
Thermodynamic parameters for terminal mismatches. Only applicable for the NN method. Default: "DNA_TMM_Bommarito_2000" |
imm_table |
Thermodynamic parameters for internal mismatches. Only applicable for the NN method. Default: "DNA_IMM_Peyret_1999" |
de_table |
Thermodynamic parameters for dangling ends. Only applicable for the NN method. Default: "DNA_DE_Bommarito_2000" |
dnac_high |
Concentration of the higher concentrated strand in nM. Only applicable for the NN method. Default: 25 |
dnac_low |
Concentration of the lower concentrated strand in nM. Only applicable for the NN method. Default: 25 |
self_comp |
Logical value indicating if the sequence is self-complementary. Only applicable for the NN method. Default: FALSE |
variant |
Empirical constants coefficient for GC method. Only applicable for the GC method. Default: "Primer3Plus" |
userset |
A vector of four coefficient values for GC method. Only applicable for the GC method. Usersets override value sets. Default: NULL |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method for Tm. Default: "Schildkraut2010" Available options: - "Schildkraut2010": Updated salt correction method - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "SantaLucia1998-2": Alternative DNA salt correction - "Owczarzy2004": Comprehensive salt correction - "Owczarzy2008": Updated comprehensive salt correction Default: "Schildkraut2010" |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar" |
dmso_factor |
Coefficient of Tm decreases per percent DMSO. Default: 0.75 Other published values are 0.5, 0.6 and 0.675. |
formamide_factor |
Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72. |
mismatch |
Logical. If TRUE, every '.' in the sequence is counted as a mismatch. Only applicable for the GC method. Default: TRUE |
Details
The function calculates melting temperature using the specified method(s). For each method: - NN: Uses nearest neighbor thermodynamics with detailed sequence analysis - GC: Uses GC content-based calculation with various empirical formulas - Wallace: Uses the simple Wallace rule (2deg C per A/T, 4deg C per G/C)
The function processes the input sequence once and applies it to all selected methods, making it more efficient than calling each method separately.
Value
A TmCalculator list with:
gr |
The input |
options |
Calculation parameters and method information. |
Available Options
Method Selection:
-
method: c("tm_nn", "tm_gc", "tm_wallace")
Nearest Neighbor (NN) Method Options:
-
nn_table:"DNA_NN_Breslauer_1986"
"DNA_NN_Sugimoto_1996"
"DNA_NN_Allawi_1998"
"DNA_NN_SantaLucia_2004" (default)
"RNA_NN_Freier_1986"
"RNA_NN_Xia_1998"
"RNA_NN_Chen_2012"
"RNA_DNA_NN_Sugimoto_1995"
-
tmm_table(Terminal Mismatches):"DNA_TMM_Bommarito_2000" (default)
-
imm_table(Internal Mismatches):"DNA_IMM_Peyret_1999" (default)
-
de_table(Dangling Ends):"DNA_DE_Bommarito_2000" (default)
"RNA_DE_Turner_2010"
GC Method Options:
-
variant:"Primer3Plus" (default)
"Chester1993"
"QuikChange"
"Schildkraut1965"
"Wetmur1991_MELTING"
"Wetmur1991_RNA"
"Wetmur1991_RNA/DNA"
"vonAhsen2001"
Salt Correction Options:
-
salt_method:"Schildkraut2010" (default)
"Wetmur1991"
"SantaLucia1996"
"SantaLucia1998-1"
"SantaLucia1998-2"
"Owczarzy2004"
"Owczarzy2008"
Formamide Unit Options:
-
formamide_unit$unit:"percent" (default)
"molar"
Other Parameters:
-
ambiguous: TRUE/FALSE (default: FALSE) -
shift: Integer value (default: 0) -
dnac_high: Numeric value in nM (default: 25) -
dnac_low: Numeric value in nM (default: 25) -
self_comp: TRUE/FALSE (default: FALSE) -
Na: Millimolar concentration (default: 50) -
K: Millimolar concentration (default: 0) -
Tris: Millimolar concentration (default: 0) -
Mg: Millimolar concentration (default: 0) -
dNTPs: Millimolar concentration (default: 0) -
DMSO: Percent concentration (default: 0) -
dmso_factor: Numeric value (default: 0.75) -
formamide_factor: Numeric value (default: 0.65) -
mismatch: TRUE/FALSE (default: TRUE)
Author(s)
Junhui Li
Examples
## Not run:
input_seq <- c("chr1:1000100-1000150:+:BSgenome.Hsapiens.UCSC.hg38")
result <- tm_calculate(
input_seq,
method = "tm_nn",
nn_table = "DNA_NN_SantaLucia_2004",
salt_method = "Owczarzy2008"
)
## End(Not run)
Calculate the melting temperature using empirical formulas based on GC content
Description
Calculate the melting temperature using empirical formulas based on GC content with different options. The function returns a list of sequences with updated Tm attributes and calculation options.
Usage
tm_gc(
gr_seq,
ambiguous = FALSE,
userset = NULL,
variant = c("Primer3Plus", "Chester1993", "QuikChange", "Schildkraut1965",
"Wetmur1991_MELTING", "Wetmur1991_RNA", "Wetmur1991_RNA/DNA", "vonAhsen2001"),
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"Owczarzy2004", "Owczarzy2008"),
mismatch = TRUE,
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65
)
Arguments
gr_seq |
Pre-processed sequence(s) in 5' to 3' direction. This should be the output from to_genomic_ranges() function. |
ambiguous |
Logical. If TRUE, ambiguous bases are taken into account when computing the G and C content. The function handles various ambiguous bases (S, W, M, K, R, Y, V, H, D, B) by proportionally distributing their contribution to GC content based on their possible nucleotide compositions. |
userset |
A vector of four coefficient values. Usersets override value sets. |
variant |
Empirical constants coefficient with 8 variants: - Chester1993: Tm = 69.3 + 0.41(Percentage_GC) - 650/N - QuikChange: Tm = 81.5 + 0.41(Percentage_GC) - 675/N - Percentage_mismatch - Schildkraut1965: Tm = 81.5 + 0.41( - Wetmur1991_MELTING: Tm = 81.5 + 0.41( - Wetmur1991_RNA: Tm = 78 + 0.7( - Wetmur1991_RNA/DNA: Tm = 67 + 0.8( - Primer3Plus: Tm = 81.5 + 0.41( - vonAhsen2001: Tm = 77.1 + 0.41( Salt correction is applied only for variants that include it in the formula
(via |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method. |
mismatch |
Logical. If TRUE (default), every 'X' in the sequence is counted as a mismatch |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: Numeric value of formamide concentration - unit: Either "percent" or "molar" |
dmso_factor |
Coefficient of Tm decreases per percent DMSO. Default: 0.75 (von Ahsen et al. 2001) Other published values are 0.5, 0.6 and 0.675. |
formamide_factor |
Coefficient of Tm decrease per percent formamide. Default: 0.65 Several papers report factors between 0.6 and 0.72. |
Value
Returns a list with two components: - Tm: A list of sequences with updated Tm attributes - Options: A list containing calculation parameters and method information
Author(s)
Junhui Li
References
Marmur J, Doty P. Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal of Molecular Biology, 1962, 5(1):109-118.
Schildkraut C. Dependence of the melting temperature of DNA on salt concentration. Biopolymers, 2010, 3(2):195-208.
Wetmur JG. DNA Probes: Applications of the Principles of Nucleic Acid Hybridization. CRC Critical Reviews in Biochemistry, 1991, 26(3-4):33.
Untergasser A, Cutcutache I, Koressaar T, et al. Primer3–new capabilities and interfaces. Nucleic Acids Research, 2012, 40(15):e115-e115.
von Ahsen N, Wittwer CT, Schutz E, et al. Oligonucleotide melting temperatures under PCR conditions: deoxynucleotide Triphosphate and Dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clin Chem 2001, 47:1956-1961.
Examples
# Example with multiple sequences
input_seq <- c("ATCGTGCGTAGCAGTACGATCAGTAG", "ATCGTGCGTAGCAGTACGATCAGTAG")
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_gc(gr_seq, ambiguous = TRUE, variant = "Primer3Plus", Na = 50, mismatch = TRUE)
out
out$Options
Calculate melting temperature using nearest neighbor thermodynamics
Description
Calculate melting temperature using nearest neighbor thermodynamics. The function checks if all sequence combinations in the input sequence are present in the thermodynamic parameter tables before performing calculations.
Usage
tm_nn(
gr_seq,
ambiguous = FALSE,
shift = 0,
nn_table = c("DNA_NN_SantaLucia_2004", "DNA_NN_Breslauer_1986", "DNA_NN_Sugimoto_1996",
"DNA_NN_Allawi_1998", "RNA_NN_Freier_1986", "RNA_NN_Xia_1998", "RNA_NN_Chen_2012",
"RNA_DNA_NN_Sugimoto_1995"),
tmm_table = "DNA_TMM_Bommarito_2000",
imm_table = "DNA_IMM_Peyret_1999",
de_table = c("DNA_DE_Bommarito_2000", "RNA_DE_Turner_2010"),
dnac_high = 25,
dnac_low = 25,
self_comp = FALSE,
Na = 50,
K = 0,
Tris = 0,
Mg = 0,
dNTPs = 0,
salt_method = c("Schildkraut2010", "Wetmur1991", "SantaLucia1996", "SantaLucia1998-1",
"Owczarzy2004", "Owczarzy2008"),
DMSO = 0,
formamide_unit = list(value = 0, unit = "percent"),
dmso_factor = 0.75,
formamide_factor = 0.65
)
Arguments
gr_seq |
Pre-processed sequence(s) in 5' to 3' direction. This should be the output from to_genomic_ranges() function. |
ambiguous |
Logical value controlling how ambiguous bases are handled: - TRUE: Ambiguous bases (e.g., N, R, Y) are included in calculations - FALSE (default): Ambiguous bases are excluded from calculations |
shift |
Integer value controlling the alignment offset between primer and template sequences. Visual representation of different shift values: shift = 0 (default): Primer: 5' ATGCG 3' Template: 3' TACGC 5' shift = -1: Primer: 5' ATGCG 3' Template: 3' TACGC 5' ^ shift = 1: Primer: 5' ATGCG 3' Template: 3' TACGC 5' ^ The shift parameter is necessary when: - Sequences have different lengths - Dangling ends are required - Specific alignment positions are needed |
nn_table |
Thermodynamic nearest-neighbor parameters for different nucleic acid hybridizations. Eight parameter sets are available, organized by hybridization type: DNA/DNA hybridizations: - "DNA_NN_Breslauer_1986": Original DNA/DNA parameters - "DNA_NN_Sugimoto_1996": Improved DNA/DNA parameters - "DNA_NN_Allawi_1998": DNA/DNA parameters with internal mismatch corrections - "DNA_NN_SantaLucia_2004": Updated DNA/DNA parameters RNA/RNA hybridizations: - "RNA_NN_Freier_1986": Original RNA/RNA parameters - "RNA_NN_Xia_1998": Improved RNA/RNA parameters - "RNA_NN_Chen_2012": Updated RNA/RNA parameters with GU pair corrections RNA/DNA hybridizations: - "RNA_DNA_NN_Sugimoto_1995": RNA/DNA hybridization parameters |
tmm_table |
Thermodynamic parameters for terminal mismatches. Default: "DNA_TMM_Bommarito_2000" These parameters account for mismatches at the ends of the duplex. |
imm_table |
Thermodynamic parameters for internal mismatches. Default: "DNA_IMM_Peyret_1999" These parameters account for mismatches within the duplex, including inosine mismatches. |
de_table |
Thermodynamic parameters for dangling ends. Default: "DNA_DE_Bommarito_2000" Available options: - "DNA_DE_Bommarito_2000": Parameters for DNA dangling ends - "RNA_DE_Turner_2010": Parameters for RNA dangling ends |
dnac_high |
Concentration of the higher concentrated strand in nM. Default: 25 Typically this is the primer (for PCR) or the probe concentration. |
dnac_low |
Concentration of the lower concentrated strand in nM. Default: 25 This is typically the template concentration. |
self_comp |
Logical value indicating if the sequence is self-complementary: - TRUE: Sequence can bind to itself, dnac_low is ignored - FALSE (default): Sequence binds to a different complementary sequence |
Na |
Millimolar concentration of sodium ions. Default: 50 |
K |
Millimolar concentration of potassium ions. Default: 0 |
Tris |
Millimolar concentration of Tris buffer. Default: 0 |
Mg |
Millimolar concentration of magnesium ions. Default: 0 |
dNTPs |
Millimolar concentration of deoxynucleotide triphosphates. Default: 0 |
salt_method |
Salt correction method. Options are: Available options: - "Schildkraut2010": Updated salt correction method - "Wetmur1991": Classic salt correction method - "SantaLucia1996": DNA-specific salt correction - "SantaLucia1998-1": Improved DNA salt correction - "SantaLucia1998-2": Alternative DNA salt correction - "Owczarzy2004": Comprehensive salt correction - "Owczarzy2008": Updated comprehensive salt correction Note: Setting to NA disables salt correction |
DMSO |
Percent DMSO concentration in the reaction mixture. Default: 0 DMSO can lower the melting temperature of nucleic acid duplexes. |
formamide_unit |
Formamide concentration as 'list(value, unit)'. Default: list(value = 0, unit = "percent") - value: numeric value of formamide concentration - unit: character string specifying the unit ("percent" or "molar") Default: list(value=0, unit="percent") |
dmso_factor |
Coefficient of melting temperature (Tm) decrease per percent DMSO. Default: 0.75 (von Ahsen N, 2001, PMID:11673362) Other published values: 0.5, 0.6, 0.675 |
formamide_factor |
Coefficient of melting temperature (Tm) decrease per percent formamide. Default: 0.65 Literature reports values ranging from 0.6 to 0.72 |
Details
DNA_NN_Breslauer_1986: Breslauer K J (1986) <doi:10.1073/pnas.83.11.3746>
DNA_NN_Sugimoto_1996: Sugimoto N (1996) <doi:10.1093/nar/24.22.4501>
DNA_NN_Allawi_1998: Allawi H (1998) <doi:10.1093/nar/26.11.2694>
DNA_NN_SantaLucia_2004: SantaLucia J (2004) <doi:10.1146/annurev.biophys.32.110601.141800>
RNA_NN_Freier_1986: Freier S (1986) <doi:10.1073/pnas.83.24.9373>
RNA_NN_Xia_1998: Xia T (1998) <doi:10.1021/bi9809425>
RNA_NN_Chen_2012: Chen JL (2012) <doi:10.1021/bi3002709>
RNA_DNA_NN_Sugimoto_1995: Sugimoto N (1995)<doi:10.1016/S0048-9697(98)00088-6>
DNA_TMM_Bommarito_2000: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>
DNA_IMM_Peyret_1999: Peyret N (1999) <doi:10.1021/bi9825091> & Allawi H T (1997) <doi:10.1021/bi962590c> & Santalucia N (2005) <doi:10.1093/nar/gki918>
DNA_DE_Bommarito_2000: Bommarito S (2000) <doi:10.1093/nar/28.9.1929>
RNA_DE_Turner_2010: Turner D H (2010) <doi:10.1093/nar/gkp892>
Author(s)
Junhui Li
References
Breslauer K J , Frank R , Blocker H , et al. Predicting DNA duplex stability from the base sequence.[J]. Proceedings of the National Academy of Sciences, 1986, 83(11):3746-3750.
Sugimoto N , Nakano S , Yoneyama M , et al. Improved Thermodynamic Parameters and Helix Initiation Factor to Predict Stability of DNA Duplexes[J]. Nucleic Acids Research, 1996, 24(22):4501-5.
Allawi, H. Thermodynamics of internal C.T mismatches in DNA[J]. Nucleic Acids Research, 1998, 26(11):2694-2701.
Hicks L D , Santalucia J . The thermodynamics of DNA structural motifs.[J]. Annual Review of Biophysics & Biomolecular Structure, 2004, 33(1):415-440.
Freier S M , Kierzek R , Jaeger J A , et al. Improved free-energy parameters for predictions of RNA duplex stability.[J]. Proceedings of the National Academy of Sciences, 1986, 83(24):9373-9377.
Xia T , Santalucia , J , Burkard M E , et al. Thermodynamic Parameters for an Expanded Nearest-Neighbor Model for Formation of RNA Duplexes with Watson-Crick Base Pairs,[J]. Biochemistry, 1998, 37(42):14719-14735.
Chen J L , Dishler A L , Kennedy S D , et al. Testing the Nearest Neighbor Model for Canonical RNA Base Pairs: Revision of GU Parameters[J]. Biochemistry, 2012, 51(16):3508-3522.
Bommarito S, Peyret N, Jr S L. Thermodynamic parameters for DNA sequences with dangling ends[J]. Nucleic Acids Research, 2000, 28(9):1929-1934.
Turner D H , Mathews D H . NNDB: the nearest neighbor parameter database for predicting stability of nucleic acid secondary structure[J]. Nucleic Acids Research, 2010, 38(Database issue):D280-D282.
Sugimoto N , Nakano S I , Katoh M , et al. Thermodynamic Parameters To Predict Stability of RNA/DNA Hybrid Duplexes[J]. Biochemistry, 1995, 34(35):11211-11216.
Allawi H, SantaLucia J: Thermodynamics and NMR of internal G-T mismatches in DNA. Biochemistry 1997, 36:10581-10594.
Santalucia N E W J . Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes[J]. Nucleic Acids Research, 2005, 33(19):6258-67.
Peyret N , Seneviratne P A , Allawi H T , et al. Nearest-Neighbor Thermodynamics and NMR of DNA Sequences with Internal A-A, C-C, G-G, and T-T Mismatches, [J]. Biochemistry, 1999, 38(12):3468-3477.
Examples
input_seq <- c("AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC",
"AAAATTTTTTTCCCCCCCCCCCCCCGGGGGGGGGGGGTGTGCGCTGC")
seqs <- to_genomic_ranges(input_seq)
out <- tm_nn(seqs, Na=50)
out
Calculate the melting temperature using the 'Wallace rule'
Description
The Wallace rule is often used as rule of thumb for approximate melting temperature calculations for primers with 14 to 20 nt length.
Usage
tm_wallace(gr_seq, ambiguous = FALSE)
Arguments
gr_seq |
Pre-processed sequence(s) in 5' to 3' direction. This should be the output from to_genomic_ranges() function. |
ambiguous |
Ambiguous bases are taken into account to compute the G and C content when ambiguous is TRUE. |
Value
Returns a list of sequences with updated Tm attributes
Author(s)
Junhui Li
References
Thein S L , Lynch J R , Weatherall D J , et al. DIRECT DETECTION OF HAEMOGLOBIN E WITH SYNTHETIC OLIGONUCLEOTIDES[J]. The Lancet, 1986, 327(8472):93.
Examples
input_seq = c('acgtTGCAATGCCGTAWSDBSY','acgtTGCCCCGGCCGCGCCGTAWSDBSY') #for wallace rule
gr_seq <- to_genomic_ranges(input_seq)
out <- tm_wallace(gr_seq, ambiguous = TRUE)
out
out$Options
Convert input sequences to a GRanges object (fast backend)
Description
Drop-in replacement for to_genomic_ranges that uses the fast
coordinate backend in coor_to_genomic_ranges for genomic
coordinate input. Accepts the same input_seq and complement_seq
arguments as to_genomic_ranges, plus a list input
list(pkg_name = ..., seq = ...) for large tiling jobs.
This function processes a vector of sequences string, a FASTA file, or a character vector with genomic coordinates into a GenomicRanges object, optionally including complementary sequences. sequence names are parsed based on their format: - If names have this pattern "chr:start-end:strand:species[:name]" (e.g., "chr1:1-5:+:seq_1"), parse components into seqnames, ranges, strand, and name. - If names have this pattern "chr:start-end:strand" (e.g., "chr1:1-5:+"), parse components into seqnames, ranges, and strand. - If names have this pattern "chr:start-end" (e.g., "chr1:1-5"), parse components into seqnames and ranges. - If no names are provided, use default values: seqnames = "chr1", start = 1, width = sequence length, strand = "*", name = "1", etc. Complementary sequences are either provided or automatically generated.
Usage
to_genomic_ranges_fast(
input_seq,
complement_seq = NULL,
method = c("vectorized", "preload_chr")
)
to_genomic_ranges(input_seq, complement_seq = NULL)
Arguments
input_seq |
Input sequence(s) in 5' to 3' direction. Can be provided as either:
- A character string (e.g., c("ATGCG", "GCTAG"))
- A path to a FASTA file containing the sequence(s)
- A character vector where each element is a string in the format "chr:start-end:strand:species" #' (e.g., "chr1:100-200:+:BSgenome.Hsapiens.UCSC.hg38"). Strand is "+" for positive or "-" for negative.
- chr: Chromosome ID
- start: Start position
- end: End position
- strand: positive or negative strand
- species: Species name for reference genome (e.g., "BSgenome.Hsapiens.UCSC.hg38"), see |
complement_seq |
Optional complementary sequences. If NULL, complementary sequences will be auto-generated. otherwise, the complementary sequences will be used as metadata. Can be provided as format of input_seq. |
method |
Sequence extraction method passed to
|
Value
A GRanges object. See coor_to_genomic_ranges for
metadata columns when coordinate input is used.
A GenomicRanges object with seqnames, ranges, strand, name, sequence, Complement, and Tm as metadata.
Author(s)
Junhui Li
Examples
## Not run:
gr <- to_genomic_ranges_fast(
list(
pkg_name = "BSgenome.Hsapiens.UCSC.hg38",
seq = c("chr1:1000-1199:+:win1", "chr1:1200-1399:+:win2")
)
)
## End(Not run)
# Using a character vector with auto-generated complementary sequences
seqs <- c("ATGCG", "GCTAG")
names(seqs) <- c("chr1:1-5:+:seq_1", "chr2:1-5:+")
gr <- to_genomic_ranges(seqs)
gr
# Using a character vector with provided complementary sequences
seqs <- c("ATGCG", "GCTAG")
comp_seqs <- c("TACGC", "CGTA")
gr <- to_genomic_ranges(seqs, comp_seqs)
gr
# Using a FASTA file
gr <- to_genomic_ranges(system.file("extdata", "example1.fasta", package = "TmCalculator"))
## Not run:
# Using a character vector with genomic coordinates
seqs <- c(
"chr1:1898000-1898050:+:BSgenome.Hsapiens.UCSC.hg38",
"chr2:2563000-2563050:-:BSgenome.Hsapiens.UCSC.hg38"
)
gr <- to_genomic_ranges(seqs)
gr
## End(Not run)
Convert sequence strings to GenomicRanges object
Description
This function converts sequence strings to a GenomicRanges object, handling both named and unnamed sequences. It can also process complementary sequences if provided. sequence names can be in the format ">chr2:1-10:+:seq2" which will be parsed into chromosome, position, strand, and name components.
Usage
vec_to_genomic_ranges(input_seq)
Arguments
input_seq |
A character vector of sequences. If named with format "chr2:1-10:[+|-]:[seq_name]" the name will be parsed into GRanges components. |
Value
A GenomicRanges object containing: - GRanges information (seqnames, ranges, strand) - sequence data - Complementary sequences - Names from input or auto-generated
Examples
# Example with named sequences in GRanges format
seqs <- c("ATGCG", "GCTAG")
names(seqs) <- c("chr1:1111-1115:+:seq1", "chr2:1221-1225:+")
gr <- vec_to_genomic_ranges(seqs)
# Example with unnamed sequences
seqs <- c("ATGCG", "GCTAG")
gr <- vec_to_genomic_ranges(seqs)